Best Supplier of Molecular Products

Hmgb1 Elisa Kit Cusabio

Lab Reagents

Hmgb1 Elisa Laboratories manufactures the hmgb1 elisa kit cusabio reagents distributed by Genprice. The Hmgb1 Elisa Kit Cusabio reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact hmgb1 elisa. Other Hmgb1 products are available in stock. Specificity: Hmgb1 Category: Elisa Group: Kit Cusabio

Kit Cusabio information

HMGB1 cloning plasmid

CSB-CL010553HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

Human HMGB1 ELISA Kit

ELA-E0399h 96 Tests
EUR 824

Human HMGB1 ELISA Kit

EHH0016 96Tests
EUR 521

Goat HMGB1 ELISA Kit

EGTH0016 96Tests
EUR 521

Bovine HMGB1 ELISA Kit

EBH0016 96Tests
EUR 521

Canine HMGB1 ELISA Kit

ECH0016 96Tests
EUR 521

Chicken HMGB1 ELISA Kit

ECKH0016 96Tests
EUR 521

Anserini HMGB1 ELISA Kit

EAH0016 96Tests
EUR 521

HMGB1 ELISA KIT|Human

EF000598 96 Tests
EUR 689

Rat HMGB1 ELISA Kit

ERH0016 96Tests
EUR 521

Sheep HMGB1 ELISA Kit

ESH0016 96Tests
EUR 521

Rabbit HMGB1 ELISA Kit

ERTH0016 96Tests
EUR 521

Mouse HMGB1 ELISA Kit

EMH0016 96Tests
EUR 521

Monkey HMGB1 ELISA Kit

EMKH0016 96Tests
EUR 521

Porcine HMGB1 ELISA Kit

EPH0016 96Tests
EUR 521

Rat HMGB1 ELISA Kit

STJ150371 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in Rat serum, plasma and other biological fluids

Human HMGB1 ELISA Kit

STJ150454 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in human serum, plasma and other biological fluids