Best Supplier of Molecular Products

Protocol for a national probability survey

Protocol for a national probability survey

Protocol for a nationwide likelihood survey utilizing house specimen assortment strategies to evaluate prevalence and incidence of SARS-CoV-2 an infection and antibody response

Background: The US response to the SARS-CoV-2 epidemic has been hampered by early and ongoing delays in testing for an infection; with out information on the place infections had been occurring and the magnitude of the epidemic, early public well being responses weren’t data-driven.
Understanding the prevalence of SARS-CoV-2 infections and immune response is important to growing and implementing an efficient public well being response.
Most serological surveys have been restricted to localities that opted to conduct them and/or had been based mostly on comfort samples.
Furthermore, outcomes of antibody testing are topic to excessive false optimistic charges as a consequence of a presumably low prevalence of seroconversion and imperfect check specificity.
Strategies: We’ll conduct a nationwide serosurvey for SARS-CoV-2 positivity and immune response. A likelihood pattern of US addresses will probably be mailed invites and kits for the self-collection of anterior nares swab and finger prick dried blood spot specimens.
Inside every sampled family, one grownup 18 years or older will probably be randomly chosen and requested to finish a questionnaire and to gather and return organic specimens to a central laboratory.
Nasal swab specimens will probably be examined for SARS-CoV-2 RNA by RNA PCR; dried blood spot specimens will probably be examined for antibodies to SARS-CoV-2 (i.e., immune expertise) by enzyme-linked immunoassays.
Constructive screening checks for antibodies will probably be confirmed by a second antibody check with totally different antigenic foundation to enhance predictive worth of optimistic (PPV) antibody check outcomes.
All individuals returning specimens within the baseline section will probably be enrolled right into a follow-up cohort and mailed extra specimen assortment kits Three months after baseline.
A subset of 10% of chosen households will probably be invited to take part in full family testing, with checks supplied for all family members aged ≥Three years.
The principle research outcomes will probably be interval prevalence of an infection with SARS-CoV-2 and immune expertise and incidence of SARS-CoV-2 an infection and antibody responses.
Outcomes: Energy calculations point out {that a} nationwide pattern of 4,000 households will facilitate estimation of nationwide SARS-CoV-2 an infection and antibody prevalence with acceptably slim 95% confidence intervals throughout a number of attainable eventualities of prevalence ranges.
Oversampling in as much as 7 populous states will enable for prevalence estimation amongst sub-populations. Our 2-stage algorithm for antibody testing produces acceptable PPV at prevalence ranges ≥1.0%.
Together with oversamples in states, we count on to obtain information from as many as 9,156 individuals in 7,495 US households.
Conclusions: Along with offering strong estimates of prevalence of SARS-CoV-2 an infection and immune expertise, we anticipate this research will set up a replicable methodology for home-based SARS-CoV-2 testing surveys, tackle issues about choice bias, and enhance optimistic predictive worth of serology outcomes.
Prevalence estimates of SARS-CoV-2 an infection and immune expertise produced by this research will drastically enhance our understanding of the spectrum of COVID-19 illness, its present penetration in numerous demographic, geographic and occupational teams, and the medical vary of signs related to an infection.
These information will inform useful resource wants for management of the continuing epidemic and facilitate data-driven choices for epidemic mitigation methods.
chipab
chipab

Anti-IL-17 antibody

PAab04224 100 ug
EUR 386

IL-17, Interleukin-17 IL-17A, human

RC212-28 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IL-6, Interleukin-6, human

RC212-17 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IL-17, Human

HY-P7036 10ug
EUR 211

IL-17

E5-00007 1mg
EUR 960

IL-17

EF014060 96 Tests
EUR 689

IL-17

MO15110 500 ug
EUR 910

IL-17

PR27113 5 ug
EUR 191

Anti-IL-17 alpha antibody

STJ93683 200 µl
EUR 197
Description: Rabbit polyclonal to IL-17Ralpha.

IL-17/IL-17A

E21-021 10ug
EUR 343

IL-6, Interleukin-6, rat

RC252-17 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Recombinant Human IL-17

SJB09-03 25µg/vial
EUR 256

Interleukin 17 (IL-17) Antibody

abx234224-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Interleukin 17 (IL-17) Antibody

abx234225-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Bovine Interleukin 17(IL-17)

QY-E60069 96T
EUR 426

IL-6, Interleukin-6, murine (mouse)

RC232-17 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

IL-17 Antibody

24784-100ul 100ul
EUR 390

IL-17 Antibody

24789-100ul 100ul
EUR 390

IL-17 Antibody

5176-100
EUR 338

Human Interleukin 17,IL-17 ELISA Kit

201-12-0143 96 tests
EUR 440
  • This Interleukin 17 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 17 (IL-17) CLIA Kit

abx195860-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Interleukin 17,IL-17 ELISA Kit

CN-03335H1 96T
EUR 434

Human Interleukin 17,IL-17 ELISA Kit

CN-03335H2 48T
EUR 284

Human Interleukin 17(IL-17)ELISA Kit

GA-E0081HM-48T 48T
EUR 289

Human Interleukin 17(IL-17)ELISA Kit

GA-E0081HM-96T 96T
EUR 466

IL-17 Interleukin-17 Human Recombinant Protein

PROTQ16552-1 Regular: 25ug
EUR 317
Description: Interleukin-17A Human Recombinant produced in E.Coli is a homodimeric, non-glycosylated polypeptide chain containing a total of 264 amino acids (2 chains of 132 aa) and having a molecular mass of 31kDa.  ;The IL-17 is purified by proprietary chromatographic techniques.

Human Interleukin 17(IL-17)ELISA Kit

QY-E04323 96T
EUR 361

Recombinant Human IL-17 (IL-17A) Protein

PROTQ16552-4 25ug
EUR 317
Description: The originally described IL-17 protein, now known as IL-17A, is a homodimer of two 136 amino acid chains, secreted by activated T-cells that act on stromal cells to induce production of proinflammatory and hematopoietic bioactive molecules.  Today, IL-17 represents a family of structurally-related cytokines that share a highly conserved C-terminal region but differ from one another in their N-terminal regions and in their distinct biological roles.  The six known members of this family, IL-17A through IL-17F, are secreted as homodimers.  IL-17A exhibits cross-species bioactivity between human and murine cells.  Recombinant human IL-17A is a 31.3 kDa disulfide-linked homodimer of two 137 amino acid polypeptide chains.

IL-6, Interleukin-6, monkey (rhesus macaque)

RC222-17 2ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

human IL-17, His tag

E410A10-100 100μg
EUR 960

IL-17 (Human) ELISA Kit

E4628-100
EUR 729

IL-17 ELISA KIT|Human

EF006939 96 Tests
EUR 689

Human IL-17 ELISA kit

LF-EK50201 1×96T
EUR 648

Human Interleukin 17 (IL-17) Detection Assay Kit

6808 1 kit
EUR 483.55
Description: Human Interleukin 17 (IL-17) Detection Assay Kit

ELISA kit for Human IL-17 (Interleukin 17)

E-EL-H0105 1 plate of 96 wells
EUR 377
  • Gentaur's IL-17 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-17. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-17 (Interleukin 17) in samples from Serum, Plasma, Cell supernatant

CLIA kit for Human IL-17 (Interleukin 17)

E-CL-H0104 1 plate of 96 wells
EUR 584
  • Gentaur's IL-17 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human IL-17 . Standards or samples are added to the micro CLIA plate wells and combined with th
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human IL-17 (Interleukin 17) in samples from Serum, Plasma, Cell supernatant

IL-17 Interleukin-17 Human Recombinant Protein, HEK

PROTQ16552 Regular: 10ug
EUR 317
Description: IL-17 Human Recombinant produced in HEK cells is a glycosylated homodimer, having a molecular weight range of 30-35kDa due to glycosylation.;The IL-17 is purified by proprietary chromatographic techniques.

17-Hydroxyprogesterone (17-OHP) ELISA Kit

DLR-17-OHP-Ge-48T 48T
EUR 469
  • Should the 17-Hydroxyprogesterone (17-OHP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 17-Hydroxyprogesterone (17-OHP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

17-Hydroxyprogesterone (17-OHP) ELISA Kit

DLR-17-OHP-Ge-96T 96T
EUR 608
  • Should the 17-Hydroxyprogesterone (17-OHP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of 17-Hydroxyprogesterone (17-OHP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Polyclonal IL-17 Antibody

APR06508G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IL-17 . This antibody is tested and proven to work in the following applications:

Polyclonal IL-17 Antibody

APR06512G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IL-17 . This antibody is tested and proven to work in the following applications:

rHu IL-17-A

AK8249-0005 5µg Ask for price

rHu IL-17-A

AK8249-0025 25µg Ask for price

rHu IL-17-A

AK8249-0100 100µg Ask for price

rHu IL-17-A

AK8249-1000 1mg Ask for price

rHu IL-17-E

AK8299-0005 5µg Ask for price

rHu IL-17-E

AK8299-0025 25µg Ask for price

rHu IL-17-E

AK8299-0100 100µg Ask for price

rHu IL-17-E

AK8299-1000 1mg Ask for price

rHu IL-17-F

AK8312-0005 5µg Ask for price

rHu IL-17-F

AK8312-0025 25µg Ask for price

rHu IL-17-F

AK8312-0100 100µg Ask for price

rHu IL-17-F

AK8312-1000 1mg Ask for price

Chicken Interleukin 17, IL-17 ELISA Kit

CSB-E04607Ch-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Chicken Interleukin 17, IL-17 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Chicken Interleukin 17, IL-17 ELISA Kit

1-CSB-E04607Ch
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativecompetitive ELISA kit for measuring Chicken Interleukin 17, IL-17 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Interleukin 17, IL-17 ELISA Kit

CSB-E04608m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 17, IL-17 in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Interleukin 17, IL-17 ELISA Kit

1-CSB-E04608m
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Interleukin 17, IL-17 in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Interleukin 17 (IL-17) CLIA Kit

abx195861-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat Interleukin 17 (IL-17) CLIA Kit

abx195862-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Interleukin-17, IL-17 ELISA Kit

ELA-E0063d 96 Tests
EUR 928

Porcine Interleukin-17, IL-17 ELISA Kit

ELA-E0063p 96 Tests
EUR 928

Rat Interleukin 17, IL- 17 ELISA Kit

ELA-E0063r 96 Tests
EUR 886

Rabbit Interleukin-17, IL-17 ELISA Kit

ELA-E0063Rb 96 Tests
EUR 928

Hamster IL-17(Interleukin 17) ELISA Kit

EHA0007 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Hamster;Sensitivity: 18.75pg/ml

Canine IL-17(Interleukin 17) ELISA Kit

ECA0032 96T
EUR 567.6
  • Detection range: 31.25-2000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Canine;Sensitivity: 18.75pg/ml

Chicken IL-17(Interleukin 17) ELISA Kit

ECH0038 96T
EUR 567.6
  • Detection range: 15.625-1000 pg/ml
  • Alias: IL-17(Interleukin 17)/CTLA-8/IL17A/IL-17CTLA-8/IL17interleukin-17A/interleukin 17A
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Chicken;Sensitivity: 9.375pg/ml

Rabbit Interleukin 17,IL-17 ELISA Kit

CN-00640R1 96T
EUR 452

Rabbit Interleukin 17,IL-17 ELISA Kit

CN-00640R2 48T
EUR 302

Chicken Interleukin 17,IL-17 ELISA Kit

CN-00838C1 96T
EUR 452

Chicken Interleukin 17,IL-17 ELISA Kit

CN-00838C2 48T
EUR 302

PoFAine interleukin 17,IL-17 ELISA Kit

CN-01210P2 48T
EUR 326

PoFAine interleukin 17,IL-17 ELISA Kit

CN-01211P1 96T
EUR 449

PoFAine interleukin 17,IL-17 ELISA Kit

CN-01211P2 48T
EUR 299

Rat Interleukin 17, IL-17 ELISA KIT

CSB-E07451r-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 17, IL-17 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Interleukin 17, IL-17 ELISA KIT

1-CSB-E07451r
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Interleukin 17, IL-17 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig interleukin 17, IL-17 ELISA Kit

CSB-E08057p-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig interleukin 17, IL-17 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Pig interleukin 17, IL-17 ELISA Kit

1-CSB-E08057p
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig interleukin 17, IL-17 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit Interleukin 17, IL-17 ELISA Kit

CSB-E08058Rb-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit Interleukin 17, IL-17 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rabbit Interleukin 17, IL-17 ELISA Kit

1-CSB-E08058Rb
  • EUR 603.00
  • EUR 4247.00
  • EUR 2260.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit Interleukin 17, IL-17 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Bovine Interleukin 17(IL-17) ELISA Kit

CSB-E14207B-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine Interleukin 17 (IL-17) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Bovine Interleukin 17(IL-17) ELISA Kit

1-CSB-E14207B
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Bovine Interleukin 17(IL-17) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Canine Interleukin 17(IL-17)ELISA Kit

CSB-E17935c-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Canine Interleukin 17 (IL-17) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Canine Interleukin 17(IL-17)ELISA Kit

1-CSB-E17935c
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Canine Interleukin 17(IL-17) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Interleukin 17,IL-17 ELISA KIT

CN-01495R1 96T
EUR 449

Security Analysis of an Alpha-Emitter Bismuth-213 Labeled Antibody to (1→3)-β-Glucan in Wholesome Canines as a Prelude for a Trial in Companion Canines with Invasive Fungal Infections

 

Background: With the restricted choices accessible for remedy to deal with invasive fungal infections (IFI), radioimmunotherapy (RIT) can probably supply an efficient various therapy.
Microorganism-specific monoclonal antibodies have proven promising ends in the experimental therapy of fungal, bacterial, and viral infections, together with our current and inspiring outcomes from treating mice contaminated with Blastomyces dermatitidis with 213Bi-labeled antibody 400-2 to (1→3)-β-glucan.
On this work, we carried out a security research of 213Bi-400-2 antibody in wholesome canines as a prelude for a medical trial in companion canines with acquired invasive fungal infections and in a while in human sufferers with IFI.
Strategies: Three feminine beagle canines (≈6.1 kg physique weight) had been handled intravenously with 155.3, 142.5, or 133.2 MBq of 213Bi-400-2 given as three subfractions over an eight h interval. RBC, WBC, platelet, and blood serum biochemistry parameters had been measured periodically for six months publish injection.
Outcomes: No important acute or long-term unintended effects had been noticed after RIT injections; just a few parameters had been mildly and transiently exterior reference change worth limits, and a transient atypical morphology was noticed within the circulating lymphocyte inhabitants of two canines. Conclusions: These outcomes reveal the protection of systemic 213Bi-400-2 administration in canines and supply encouragement to pursue analysis of RIT of IFI in companion canines.
Key phrases: 1-3-beta-glucan; bismuth-213; canines; invasive fungal infections; radioimmunotherapy.

Anti-RPL27 antibody

PAab07426 100 ug
EUR 386

Anti-RPL27 antibody

STJ27732 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L27E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL27 antibody

STJ115011 100 µl
EUR 277
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L27E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

RPL27 antibody

70R-19975 50 ul
EUR 435
Description: Rabbit polyclonal RPL27 antibody

RPL27 antibody

70R-2387 50 ug
EUR 467
Description: Rabbit polyclonal RPL27 antibody raised against the middle region of RPL27

RPL27 antibody

70R-15200 100 ug
EUR 327
Description: Rabbit polyclonal RPL27 antibody

RPL27 Antibody

45730-100ul 100ul
EUR 252

RPL27 Antibody

45730-50ul 50ul
EUR 187

RPL27 Antibody

DF9129 200ul
EUR 304
Description: RPL27 Antibody detects endogenous levels of total RPL27.

RPL27 Antibody

1-CSB-PA02345A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

RPL27 Antibody

1-CSB-PA020213GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RPL27 Antibody

ABD9129 100 ug
EUR 438

RPL27 antibody (HRP)

60R-1439 100 ug
EUR 327
Description: Rabbit polyclonal RPL27 antibody (HRP)

RPL27 antibody (FITC)

60R-1440 100 ug
EUR 327
Description: Rabbit polyclonal RPL27 antibody (FITC)

RPL27 antibody (biotin)

60R-1441 100 ug
EUR 327
Description: Rabbit polyclonal RPL27 antibody (biotin)

RPL27 Conjugated Antibody

C45730 100ul
EUR 397

RPL27 Polyclonal Antibody

A52708 100 µg
EUR 570.55
Description: fast delivery possible

Rpl27/ Rat Rpl27 ELISA Kit

ELI-14431r 96 Tests
EUR 886

RPL27 siRNA

20-abx904658
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL27 siRNA

20-abx931948
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL27 siRNA

20-abx931949
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-RPL27

PVT18575 2 ug
EUR 231

RPL27 Antibody, HRP conjugated

1-CSB-PA02345B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL27 Antibody, FITC conjugated

1-CSB-PA02345C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL27 Antibody, Biotin conjugated

1-CSB-PA02345D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL27. Recognizes RPL27 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

RPL27 Rabbit pAb

A13044-100ul 100 ul
EUR 308

RPL27 Rabbit pAb

A13044-200ul 200 ul
EUR 459

RPL27 Rabbit pAb

A13044-20ul 20 ul
EUR 183

RPL27 Rabbit pAb

A13044-50ul 50 ul
EUR 223

RPL27 Blocking Peptide

33R-8904 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL27 antibody, catalog no. 70R-2387

RPL27 Blocking Peptide

DF9129-BP 1mg
EUR 195

RPL27 cloning plasmid

CSB-CL020213HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 411
  • Sequence: atgggcaagttcatgaaacctgggaaggtggtgcttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagctgccatgggcaa
  • Show more
Description: A cloning plasmid for the RPL27 gene.

RPL27 cloning plasmid

CSB-CL020213HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 423
  • Sequence: atgatcaaaacaaagcatctaaaaccgcagtttctggaagaaccacttgtcctggctggacgctactccggacgcaaagctgtcatcgtgaagaacattgatgatggcacctcagatcgcccctacagccatgctctggtggctggaattgaccgctacccccgcaaagtgacagc
  • Show more
Description: A cloning plasmid for the RPL27 gene.

RPL27 Rabbit pAb

A5936-100ul 100 ul
EUR 308

RPL27 Rabbit pAb

A5936-200ul 200 ul
EUR 459

RPL27 Rabbit pAb

A5936-20ul 20 ul Ask for price

RPL27 Rabbit pAb

A5936-50ul 50 ul Ask for price

Ribosomal Protein L27 (RPL27) Antibody

20-abx004552
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody

20-abx218355
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody

20-abx115236
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody

abx122993-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ribosomal Protein L27 (RPL27) Antibody

abx237426-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RPL27 Polyclonal Antibody, Biotin Conjugated

A52705 100 µg
EUR 570.55
Description: kits suitable for this type of research

RPL27 Polyclonal Antibody, FITC Conjugated

A52706 100 µg
EUR 570.55
Description: fast delivery possible

RPL27 Polyclonal Antibody, HRP Conjugated

A52707 100 µg
EUR 570.55
Description: reagents widely cited

Ribosomal Protein L27 (RPL27) Antibody Pair

abx117454-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

60S Ribosomal Protein L27 (RPL27) Antibody

20-abx109469
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RPL27 ELISA KIT|Human

EF002583 96 Tests
EUR 689

Canine RPL27 ELISA KIT

ELI-42598d 96 Tests
EUR 928

Mouse RPL27 shRNA Plasmid

20-abx972493
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RPL27 shRNA Plasmid

20-abx986199
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPL27 shRNA Plasmid

20-abx954140
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL27 Recombinant Protein (Human)

RP026929 100 ug Ask for price

RPL27 Recombinant Protein (Human)

RP026932 100 ug Ask for price

RPL27 Recombinant Protein (Mouse)

RP169013 100 ug Ask for price

RPL27 Recombinant Protein (Rat)

RP226649 100 ug Ask for price

Rpl27 ORF Vector (Rat) (pORF)

ORF075551 1.0 ug DNA
EUR 506

RPL27 ORF Vector (Human) (pORF)

ORF008977 1.0 ug DNA
EUR 95

RPL27 ORF Vector (Human) (pORF)

ORF008978 1.0 ug DNA
EUR 95

Rpl27 ORF Vector (Mouse) (pORF)

ORF056339 1.0 ug DNA
EUR 506

Rpl27 sgRNA CRISPR Lentivector set (Mouse)

K4890901 3 x 1.0 ug
EUR 339

Rpl27 sgRNA CRISPR Lentivector set (Rat)

K6935401 3 x 1.0 ug
EUR 339

RPL27 sgRNA CRISPR Lentivector set (Human)

K1952401 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L27 (RPL27) ELISA Kit

abx382911-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rpl27 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4890902 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4890903 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4890904 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6935402 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6935403 1.0 ug DNA
EUR 154

Rpl27 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6935404 1.0 ug DNA
EUR 154

RPL27 sgRNA CRISPR Lentivector (Human) (Target 1)

K1952402 1.0 ug DNA
EUR 154